Сигнал-распознающие частицы и повторы, Алу

Изменено: 01.07.2019 Posted on

Понять геном можно через связь его элементов и отражение хим. молекул, см. нобелевские и ген.паспорт. Кроме НСО главные элементы — азот, фосфор и сера. В 1869 — в ядрах клеток вещество «нуклеин» Фридрих Мишер, швейцарский биолог, выделил из спермы лосося. 1900 — голландец Гуго де Фриз, немец Карл Эрих Корренс и австриец Эрих Чермак-Зейзенегг независимо переоткрыли законы Грегора Менделя о наследственности, генетику. После Моргана и Меллера открыли мутагенез, в 1929 и русские Александр Серебровский и Николай Дубинин формулировали гипотезу о делимости гена, измерения его размеров в единицах кроссинговера, ввели понятие генофонда популяции.

Нобелевские по физиологии и медицине — Kossel(1910) описал нуклеиновое вещество, пурины, Генетики (33-46-83) Морган (1933) — роль хромосом в наследственности, Мюллер (1946) — мутации при рентгеновском облучении.

Но только в 40-х открыли роль НК, Молекулярная Биология / Генетика (1958-59-62-65-68-69-78- * 93) переходили от белков к НК: Beadle Tatum (gen — хим.- один белок) Lederberg (1958) генетическая рекомбинация и организация генетического материала в бактериях Ochoa Kornberg (1959) биосинтез рибонуклеиновой и дезоксирибонуклеиновой кислоты

CrickWatson Wilkins (1962) молекулярная структура нуклеиновых кислот и ее значение для передачи информации в живом материале — 25.4.1953 — Фрэнсис Крик и Джеймс Уотсон создали структурную модель ДНК в виде двойной спирали. В 60-х отметили JacobLwoff Monod (1965) за генетический контроль синтеза фермента и вируса, HolleyKhorana Nirenberg (1968)- генетический код и его функция в синтезе белка DelbrückHershey Luria (1969)- механизм репликации и генетическая структура вирусов Мак-Клинток (1983) — мобильные генетические элементы  Робертс & Шарп(1993) 2006  А.Файр и Крейг Мелло С.«открытие РНК-интерференции — подавления экспрессии генов с помощью двухцепочечной РНК»2007  Р. Марио Капеччисэр Мартин Эванси О.«введения специфических генных модификаций у мышей с использованием эмбриональных стволовых клеток» 2009 Элизабет БлэкбернК. грейдер и Шостак«как хромосомы защищены теломерами и фермент теломеразы»2012 сэр Джон Б. Гердон и Яманака «зрелые клетки могут быть перепрограммированы и стать плюрипотентными»

1977 — предложена технология определения последовательности ДНК — секвенирование по Сенгеру (фрагмент около 500 нуклеотидов). ArberNathans Smith (1978) открыли ферменты рестриктазы

1990 — стартовал международный проект «Геном человека» — определение полной последовательности ДНК человека (потребовал 10 лет и $5 млрд), 1995 — создана первая база данных генетических паспортов. 1998 — предложена технология секвенирования нового поколения Illumina (в 2012 г. — в 1 день за $1000).2000 — получена последовательность генома человека.2003 — проект полностью завершен. На 2018 — остаются около 514 участков ДНК, определить правильную последовательность еще технологически невозможно. в мире Великобритания — с 1995 года по программе NDNAD (Национальная база данных ДНК) собрано более 6 млн генетических паспортов, в основном от осужденных преступников. в криминалистике, как и в США — самая большая база генетических паспортов — более 9 млн, также… и более 50 млн образцов крови военнослужащих и членов их семей, м.б.для получения генетических паспортов. Франция — с 1998 года собрано около 4 млн генетических паспортов, Дубай — в 2017 году полная генетическая паспортизация населения в медицинских целях за 10 лет стала одним из «прорывных инновационных проектов»;  с целью борьбы с терроризмом, в Кувейте реализовать не удалось. Исландия — секвенирования геномов в научных и, возможно, коммерческих целях более 30% населения (более 100 тыс. человек). информации о генетических заболеваниях при сопоставлении с медицинскими картами, но общество воспринимает этот проект неоднозначно.

2019 — предложено создать генетический паспорт в России. В сельском хозяйстве обещали 25% прироста производительности при охвате российских стад генетическими паспортами, отслеживать происхождение ввозимой продукции, контролировать на таможне виды и сорта не по справке, а по факту.

В Юлия МакароваСколько у нас генов?«ХИМИЯ И ЖИЗНЬ» №4, 2019 • ГЕНЕТИКА — методы Сэнгера, определения последовательности белков (НП) и ДНК (секвенирования, 1977, ХиЖ № 8-18) расшифровали первые геномы, от вирусов до бактерий (в 95- Haemophilis influenza) и эукариот, клетки (96- дрожжей Saccharomyces cerevisiae), червей, 98- нематоды Caenorhabditis elegans. Проект «Геном человека» 1990-2003  определение нуклеотидной последовательности ДНК — локализация человеческих генов (предполагали 100 000, бесценный инструмент: расшифровки молекулярных механизмов болезней — рака, шизофрении, деменции) в «черновой» версии летом 2000 года, 27.5.04  опубликовал «полную» последовательность генома (секвенировалась только ДНК в составе эухроматина, в неплотно упакованном состоянии, 8% гетерохроматин, компактно уложенная ДНК, центромер и теломер — концов хромосом и участков, к которым прикрепляются нити веретена деления, слабо транскрибируются, содержат относительно мало генов, но богаты повторами, что затрудняет сборку. К 2019 разрывов еще больше 500, см. Genome Reference Consortium.

В 2010 году по инициативе Организации по изучению протеома человека (HUPO — Human Proteome Organization) запущен одноименный проект — «Протеом человека», составить полный список человеческих белков, с каждого гена, описать их однонуклеотидные полиморфизмы (отличия в одну «букву»), варианты сплайсинга мРНК и посттрансляционной модификации белков.

В аннотированных базах знаний, по достоверности наших сведений PE1-5 означает protein existence, на 3.2019 neXtProt содержала 17694 белков экспериментально подтверждено, 1548 с известными мРНК, 510 — на основании гомологии с другими белками (гены разных видов эукариот в силу общности эволюционного происхождения сходные), 71  по последовательности ДНК, и 576 сомнительных .

*экспериментально не доказано, — так называемые потерянные (missing) белки- все вышеперечисленные группы, кроме первой см. MissingProteinPedia. Кроме матричных мРНК, служащие матрицей для синтеза белков и некодирующих — инфраструктурные РНК из школьных учебников — рибосомные РНК (рРНК) и транспортные РНК (тРНК). Регуляторные нкРНК классифицируются в зависимости от размера и выполняют важные функции (см. таблицу 1), «вкл.—выкл.» не большие

Таблица 1. Некодирующие регуляторные РНК

НазваниеДлина
(нуклеотиды)
Функции
Длинные некодирующие РНК (днкРНК, lncRNA)2001. Регулируют избирательное метилирование ДНК
2. Руководят избирательной посадкой на хроматин белковых комплексов, подавляющих активность генов
Малые РНК
Малые ядерные РНК (мяРНК, snRNA)1501. Участвуют в сплайсинге
2. Регулируют активность факторов транскрипции
3. Поддерживают целостность теломер
Малые ядрышковые РНК (мякРНК, snoRNA)60–3001. Участвуют в химической модификации рРНК, тРНК и мяРНК
2. Возможно, участвуют в стабилизации структуры рРНК и защите от действия ферментов гидролаз
Малые интерферирующие РНК (миРНК, siRNA)21–221. Обеспечивают антивирусную иммунную защиту
2. Подавляют активность собственных генов
МикроРНК (мкРНК, miRNA)18–25Подавляют трансляцию путем РНК-интерференции
Антисмысловые РНК (asRNA)1. Короткие: менее 200
2. Длинные: более 200
Блокируют трансляцию, образуя гибриды с мРНК
РНК, связанные с белками Piwi (piRNA, piwiRNA)26–32Их называют «стражами генома», они подавляют активность мобильных генетических элементов во время эмбриогенеза

в первом докладе о геноме 2001 года «тысячи генов человека продуцируют некодирующие РНК (нкРНК), являющиеся их конечным продуктом», о 706 генов нкРНК. Публикация проекта «Геном человека» 2001 года оценила количество белок-кодирующих генов в 31 000, а группа Вентера уточнила число 26 588. В 2004  снизилось до 24 000, в Ensembl (версия 34d) с 22 287 белок-кодирующих генов и 34 214 транскриптов. Скорее всего, генов, кодирующих белки, у человека около 20 000 . Но Новое секв… 15 лет только две список генов: RefSeqи Ensembl / Gencode. Национальным центром биотехнологической информации при НИЗ США, вторая — Европейской молекулярно-биологической лабораторией — подпроект консорциума ENCODE, «масштабной научной экспедиции в пустыни генома, не кодирующего белки» (ХиЖ № 10, 2012) сотни различий по белок-кодирующим генам, тысячи — по генам длинных некодирующих РНК (см. Таблица 2. Количество разных типов генов в базах данных GencodeRefSeq, CHESS

Типы геновGencodeRefSeqCHESS
Белок-кодирующие гены19 90120 34521 306
Гены длинных некодирующих РНК15 77917 71218 484
Антисмысловые РНК5501282694
Другие некодирующие РНК221313 8994347
Псевдогены14 72315 952
Общее число транскриптов (видов РНК)203 835154 484323 827

По: BMC Biology, 2018, 16:94

В 2017 году сотрудники Университета Джонса Хопкинса под руководством Стивена Зальцберга создали еще одну базу данных генов человека — CHESS. включает все белок-кодирующие гены как Gencode, так и RefSeq, определяя «Ген — любой участок хромосомной ДНК, который транскрибируется в функциональную молекулу РНК или сначала транскрибируется в РНК, а затем транслируется в функциональный белок» включает как гены некодирующих РНК, так и белок-кодирующие гены, но исключает псевдогены — нефункциональные остатки структурных генов, утратившие способность кодировать белок. … (особенно гены lncRNA), видимо, имеют высокую тканеспецифичность. более 20 тысяч генов белков, а вместе с генами РНК — возможно, 200–300 тысяч, но, может быть, и меньше.

книгу Майкла Линча “ происхождение архитектуры генома”. для элементов в геномах эукариот с ядром в их клетках, включая людей,  почему это так. сколько ДНК вообще находится на земле. Это, безусловно, проблема Ферми, видов эукариот…сколько людей на вид, сколько клеток тела на человека и сколько ДНК на клетку! Линч также цитирует (около 2 метров ДНК. 0,34 нм, или 3×10-10 м. на чуть более 3 млрд оснований, или 3×109. почти…) метра. каждая хромосома два раза (одна от матери, одна от отца), 2 метра ДНК в каждой из наших клеток! средний размер наших клеток составляет всего от 10 до 100 мкм [1]!

Серу и ОВ может отражать * Alu-класс коротких диспергированных повторов (SINEs) — последовательность ДНК, открытая при обработке рестриктазой Alu. Преобладает в геномах приматов, самый распространенный в геноме человека с около 1 млн копий Alu-повтора, 10,7 % всего генома.[2] Он произошёл от гена, кодирующего 7SL РНК – компонента СРП[en] у предков приматов.[1] Это важно для генетики популяций человека и вопросов эволюции его, приматов, наследственных заболеваний человека и форм рака, с Инсерцией Alu, чаще только маркерами болезней, присутствие определённой аллели не означает обязательной болезни носителей (связи опосредованной Alu-повтором рекомбинации с наследственной предрасположенностью к раку сообщили в 1995 г.). Только 0,5 % от общего числа Alu-повторов полиморфны.[3] В 1988 году их разделили на два больших подсемейства AluS и AluJ и их подсемейства (AluS, содержащее активные Alu-повторы, назвали AluY).

Типичная структура 5′ — Часть A — A5TACA6 — часть B — PolyA Tail — 3′, где часть A и B подобны (100 mya, димер…менее 0,5% полиморфными (в 1988 Jerzy Jurka и Temple Smith обнаружили AluJ — Jurka) и AluS Смита), 65 миллионов лет, линия AluJ является самой старой и наименее активной в геноме человека. Младшая линия AluS насчитывает около 30 миллионов лет и еще содержит активные элементы, элементы AluY самые молодые и подвижные[10] 

из более чем 500 000 L1 s в геноме человека около 100 активных копий [ 10 ]. Порыв транспозиции элементов L1 и Alu в линии приматов произошел около 40 миллионов лет назад (MYA), замедление .. от 35 до 40 подсемейств элементов Alu SVA и L1 остаются активно подвижными [ 612], и все активные менее 0,05% нуклеотидов … генерируют примерно одну вставку на каждые 10-100 живорождений [ 13-15 ]. ретротранспозиции L1  1/140 и одна новая вставка Alu генерируется на каждые 20 живорождений [ 15].

гоминиды (Hominidae): орангутаныгориллышимпанзе и человек Хронограмма

Филогенетическое дерево современных семейств приматов, а также некоторых родственных отрядов млекопитающих. Цифры в узлах дерева показывают ориентировочное время расхождения филогенетических групп (млн лет) по данным молекулярной филогенетики. после названий семейств обозначают число известных видов. данные onezoom.org 07.09.2017

Приматы произошли от общего с шерстокрылами предка в верхнемеловое  65—75 млн л. н. до 79—116 млн л. н. (по молекулярным часам)[13][14].

TEs интеграции в важные гены — сорок три вызывающих заболевание вставки Alu [ 17 ]. болезни Альцгеймера … стареет, энергию клеткам мозга, к потере нейронов и слабоумию.  Алу вставки в митохондриальные гены … фиксированные элементы AluS являются гиперметилированными по сравнению с полиморфными элементами, метилирование ДНК с фиксацией Alu

…длину около 300 пар оснований и неавтономны, полагаются на L1-кодируемые белки для собственной мобилизации [ 19 ].  димерны- из левого и правого плеч с линкером и Поли(а) хвостом [ 20 ]. фиг. 1, левая рука содержит слабые (но функциональные) A и B боксы внутреннего промотора РНК-полимеразы III [ 12 ].

…связь между транспозируемыми активными элементами) и вкрапленной повторяющейся ДНК (мутированные копии их).[11]] Функциональные сайты гексамера элемента ответа ретиноевой кислоты [12]  перекрывают внутренний транскрипционный промотор . Пример мономера Alu человека длиной 153 базисных пары, полученного из 7SL РНК: Gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgaggctggaggatcgttgagtccaggagtccaggagt TCTGGGCTGTAGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGACCCCGTCTC.

Последовательность распознавания эндонуклеазы Alu I составляет 5 ‘ag / ct 3’; то есть фермент разрезает сегмент ДНК между остатками гуанина и цитозина (в нижнем регистре выше). [13]]

Элементы Alu]

отвечают за регуляцию тканеспецифических генов. транскрипцию соседних генов и могут иногда изменять способ, которым выражен ген.[14]] являются ретротранспозонами и выглядят как копии ДНК, сделанные из РНК-полимеразы III-кодируемых РНК. не кодируют белковые продукты.

Репликация и мобилизация элементов Alu начинают взаимодействиями с частицами опознавания сигнала (SRPs), помогающим протеинам достигнуть окончательные назначения.[16]  белки L1 .  Alu может контролить обратную транскриптазу белка L1, гарантируя копии в геном, а не мРНК L1.[10]]

Элементы Alu у приматов образуют ископаемую запись, вставка 100 — 200 раз в миллион лет, без механизм удаления предка [17]] .. зоны промотора для приемных устройств стероидной инкрети.[12] [19] Динуклеотидов CpG служат сайтом метилирования, способствуя до 30% сайтов метилирования в геноме человека.[20]  общим источником мутаций у людей, часто некодирующих 

Изучение подсемейств Alu-повторов привело к гипотезе о мастер-генах[4] и  связи между транспозонами (активные элементы) и диспергированными повторами (мутировавшие копии активных элементов). Ретропозиция Alu-повторов происходит через образование транскрипта РНК-полимеразой III, инсерцию транксрипта и обратную транскрипцию.[2]Alu-повторы не кодируют белковых продуктов и их репликация зависит от LINE ретротранспозонов.[5] У человека большинство инсерций Alu-повторов в тех же местах, что и в геномах других приматов, но около 7000 инсерций уникальны.[6]

Катрин Струб (Katharina Strub), профессор факультета естественных наук из Женевского Университета (University of Geneva, UNIGE, Швейцария), обнаружила две ключевые функции РНК Alu в человеческих клетках. Nucleic Acids Research. — комплекс Alu RNP позволяет клеткам адаптироваться к стрессу, обусловленному, например, химическим отравлением организма или вирусной инфекцией, регулирует числа активных рибосом. может быть частью врожденной системы клеточной защиты от специфических типов вирусов.

Возникнув у млекопитающих от общего предка, Alu-повторы в процессе эволюции увеличили свою долю в геномах приматов и человека до 10%, у грызунов их в 10 раз меньше. источник генетического разнообразия благодаря их способности свободно перемещаться по геному, двигатели эволюции.

Alu-повторы транскрибируются в молекулы РНК, которые присоединяются к специфическим белкам. «Концентрация комплекса Alu RNP значительно увеличивается в ответ на стресс, вызванный отравлением организма или вирусной инфекцией.

Защита организма от стресса

Клетки, переживающие стресс, реагируют на него путем временного формирования большого числа «стрессовых гранул», изоляции клеточных сигнальных белков с целью предотвращения гибели клетки. накапливают различные факторы (мРНК, РНК-связывающие белки и др.), для синтеза новых белков по мере нормализации условий в организме. «Когда мы обрабатываем человеческие клетки мышьяком, комплексы Alu RNP отсоединяются от белков, называемых SRP9/14. Высвободившиеся белки затем связываются с ключевыми компонентами клеточной машинерии по синтезу белков и участвуют в образовании стрессовых гранул» (Audrey Berger)

 «После стресса клетки активно синтезируют большое количество РНК Alu, которая затем присоединяется к белкам SRP9/14, в образовании и диссоциации стрессовых гранул.

Участие в борьбе против вирусов

вирусные РНК захватывают специфические рибосомальные последовательности, называемые IRES, использовать рибосомы для синтеза собственных белков.

комплексы Alu RNP выполняют защитную роль. «Они препятствуют образованию вирусных белков, инактивируя рибосомы до того момента, как они будут захвачены вирусной РНК через последовательности IRES», – говорит исследователь Елена Иванова (Elena Ivanova), синтезируют намного меньше вирусных частиц.

эти комплексы нужны клеткам для адаптации к условиям стресса, регуляции числа активных рибосом. По материалам Université de Genève Elena Ivanova, Audrey Berger, Anne Scherrer, Elena Alkalaeva, and Katharina Strub. Alu RNA regulates the cellular pool of active ribosomes by targeted delivery of SRP9/14 to 40S subunits. Nucleic Acids Research, February 2015 DOI: 10.1093/nar/gkv048

*СРП- Частица опознавания сигнала SRP ) обильный, цитозольный, универсальный рибонуклеопротеин (комплекс протеин — РНК) который узнает и прикрепляет специфические протеины к эндоплазматическому ретикулуму  eukaryotes и мембране плазматической прокариот. Открыты как «возможные предшественники легких цепей иммуноглобулина»[1]  — синтезируемые белки эукариот несут N-концевые гидрофобные сигнальные последовательности и связывают SRP [2][3] последовательности сигнала по мере выхода с рибосомы, замедляя синтез протеина (известно как «арест удлиненности»), соединение его перевода и транслокации.[4] SRP после этого прикрепляет весь комплекс рибосомы-nascent цепи к протеин-управляемому каналу, известному как translocon , в мембране ER ( эндоплазматического ретикулума), через взаимодействие и стыковку с родственным рецептором SRP [5] поблизости. У эукариот есть три домена между SRP и его рецептором, которые функционируют в связывании и гидролизе гуанозинтрифосфата (GTP), в 2 родственных субблоках в приемном устройстве SRP (SRa и Srβ) [6] и протеине SRP SRP54 (известном как FFH в бактериях).[7]  У эукариот и архей восемь спиральных элементов складываются в Домены Alu и S, разделенные длинной линкерной областью.[5] [6] координируя связывание GTP для успешного нацеливания SRP на рецептор SRP.[8][9]

После стыковки зарождающаяся пептидная цепь вставляется в канал транслокона, входит в ER. Синтез протеина возобновляет [10] [11]  диссоциация посредством гидролиза GTP[12]] — а внутри ER сигнальная последовательность отщепляется от основного белка сигнальной пептидазой, не являясь частью зрелых белков. При общей функции SRP у всех организмов, ее состав сильно различается. Ядро РНК SRP54-SRP с активностью GTPase обще всей клеточной жизни, но некоторые полипептиды субъединицы специфичны эукариотам.

ЭукариотАрхейМикроорганизм
SRP9НетНет
SRP14НетНет
SRP19ДаНет
SRP54ДаFfh
SRP72НетНет
7SL РНКДаРНК 6SL / 4.5 SL

Кристаллографические структурыS-область человеческого SRP [14]

Антитела частицы опознавания анти — сигнала не очень специфичны для полимиозита .[15]  с большей слабостью и атрофией мышцы .[15]] См. также РНК частицы распознавания сигнала